Return Styles: Pseud0ch, Terminal, Valhalla, NES, Geocities, Blue Moon.

Pages: 1-4041-

cell phone programming

Name: Anonymous 2011-08-16 21:30

does anyone here have any programming language interpreters or compilers on their cellphone for knocking out a little bit of code to pass the time? I think it would be easy to compile tinyscheme or guile to most celular platforms. I think Lua is the most popular language to get ported to cellphones.

certain persons who are delusionally paranoid that black helicopters will swoop down and wisk them away to a gulag if they turn on a cell phone need to contribute to this discussion

Name: Anonymous 2011-08-16 21:35

>>1
*need NOT contribute to this discussion
very bad typo

Name: Anonymous 2011-08-16 21:40

I have a Nokia N900 and a Neo Freerunner specifically for hacking. I just write programs in C on my development machine and compile the binaries on the same machine.

Name: Anonymous 2011-08-16 21:44

The reason why I wear my sister's black leggings and not my mom's is because my mom's black leggings don't fit me.

Name: Anonymous 2011-08-16 22:43

I do not own a cell phone because I don't enjoy having authorities know my exact location (with a 100m error or less).  Moreover, they often have backdoors so that governmental agencies can listen through an inactive (but powered-on) cellphone.  So fuck you faggot, >>1.

Name: Anonymous 2011-08-16 22:45

I got rid of my cell phone after I got tired of the exorbitant fees and contracts.

These days, I use Skype to interface with the old phone network.

Name: Anonymous 2011-08-16 23:21

>>6
Skype
proprietary closed-source shit.

Name: n3n7i 2011-08-16 23:37

>>5

>>Moreover, they often have backdoors so that governmental agencies can listen through an inactive (but powered-on) cellphone.
...And your using a computer connected to the internet? Possibly using windows...?
With its NSA Backdoors...? =D [Linux & mac// Quite probably no better....]

Smile for the -web-camera =)

Name: Anonymous 2011-08-16 23:52

>>8
You can audit the code for a GNU/Linux system to verify any sort of undesirable activity.

Name: Anonymous 2011-08-16 23:56

>>8
Not if you use a free and open source operating system and drivers. Or buy laptops devoid of such devices. Such as Thinkpads, where the web-cams are optional.

Name: Anonymous 2011-08-17 0:40

The US Government has eyes on the whole world. Hello, INTERPOL.

Name: Anonymous 2011-08-17 2:39

>>3
I just write programs in C on my development machine and compile the binaries on the same machine.
doesnt count, you have to use the compiler on the cell phone itself to qualify for this thread. I think TinyC is small enough that it would run on a N900

Name: Anonymous 2011-08-17 3:35

>>9,10
Not unless you build all of your hardware and an entire toolchain from scratch (You must first... invent the universe). http://cm.bell-labs.com/who/ken/trust.html
No amount of source-level verification or scrutiny will protect you from using untrusted code.

Name: Anonymous 2011-08-17 3:42

>>13
You could write your own C interpreter in assembly, then use that to compile gcc's code after reviewing it.

Name: Anonymous 2011-08-17 3:45

>>14
Did you even read the article?

Name: Anonymous 2011-08-17 4:20

>>15
I have, and I still can write my own assembler in machine code directly, then write a C interpreter in assembly and compile it with the assembler, then use the C interpreter to compile gcc's code after reviewing it.

Suck my dick.

Name: Anonymous 2011-08-17 4:37

>>13

If only there were some way of examining the binary instruction output generated after compiling source code, so you could cross-reference that with your CPU manual.

What might really be nice would be some sort of tool which would expand them into more reader-friendly mnemonics so you could more easily trace the execution path, but that's just asking for the moon, now.

Name: Anonymous 2011-08-17 5:26

Considering how many C compilers have sprung up recently, it's highly unlikely that a virus could have possibly propagated across all of them.

Name: Anonymous 2011-08-17 5:29

>>16
What language are you writing the assembler in, and how is the machine able to execute it?

>>17
Yeah, and I'll sure bet it's the case that those tools are the ones that are safe, right?

Name: Anonymous 2011-08-17 6:12

Tinfoil hats all over this bitch.

Name: Anonymous 2011-08-17 7:47

>>13
You don't need to build any hardware. All you really need to do is write some tests for the hardware and audit your software using the hypothetical tools alluded by >>17.

>>19
>What language are you writing the assembler in, and how is the machine able to execute it?
You can write your own hard drive controller software and input your bootstrapper software into the hard drive using a test probe.

Name: Anonymous 2011-08-17 12:16

>>19
>Yeah, and I'll sure bet it's the case that those tools are the ones that are safe, right?

Those tools, such as a simple hex dump utility that I could write myself in 2 lines of Perl?  ("but maybe the perl binary is infected too!")

Or even 'cat'ing a file?  ("but maybe cat is infected too!")

or a disk dump utility, such as 'dd', to dump a particular sector on the hard drive?  ("but blah blah blah...")

So let's build the program, remove the hard drive, install it into a DOS PC, and run debug.com against the disk sector containing the compiled program, to examine the binary data in that sector.

If ALL of the above tools, and umpteen other ways of examining binary data, show the SAME sequence of bits, cross-referenceable  with the target CPU's instruction set documentation, is it really parsimonious to believe that every single tool in the list, written and compiled across decades by different people and different compilers, are somehow magically patched to display the same sequence of data, and mask the tracks of.... something?

This isn't rocket surgery, chum........p.

Who's being a fucking paranoid nutter, now?

Name: Anonymous 2011-08-18 1:36

>>22
Consider if the NSA had the foresight to infect an early assembler  at bell labs or IBM. Every single binary in use today would be infected.

The point was, being able to audit the source code of a program will give no guarantee that it is secure, regardless of what OSS zealots would have you believe.

Name: Anonymous 2011-08-18 1:58

>>23
You don't even need a goddamned assembler to write binary code; you can directly output binary into a file, and execute it.  If you don't even trust that the disk controller will store and return the correct sequence of bytes to be executed by the CPU ("MAYBE THE NWO COMPROMISED 3COM!  ZOMG HAARP NWO REPTILIANS"), as was mentioned earlier, you can use a logic probe to directly input binary data into the bus, you delusional nutsack.

You haven't the slightest idea what you are talking about.  Go back to listening to Alex Jones.

Name: Anonymous 2011-08-18 2:02

autism all over this bitch

Name: Anonymous 2011-08-18 2:07

>>1
I think Lua is the most popular language to get ported to cellphones.
haha yeah right. not when there are languages like python which are far more suited for constrained devices

Name: Anonymous 2011-08-18 2:19

>>24
So you have presumably written your own disk driver and compi... oh wait.

If you are going to make a logic probe and verify the security of the linux kernel, go right ahead. At this stage you can do the same for Windows so the original point is moot anyway.

Name: Anonymous 2011-08-18 2:23

>>27
Yes, it's all a conspiracy.  The Illuminati backdoored the plans for the Difference Engine, and it's been downhill ever since.

FOAD.

Name: Anonymous 2011-08-18 2:46

>>27
Stop being trolled, fucktard.

Name: Anonymous 2011-08-18 2:46

FUCK I MEANT >>24,28

Name: Anonymous 2011-08-18 2:48

>>30
I have.

Name: Anonymous 2011-08-18 3:17

>>27
You have the full source code for Linux.

Name: Anonymous 2011-08-18 4:08

We have demonstrated quite conclusively that the security Linux is not easily verifiable, (when was the last time you audited the entire kernel through a logic probe?)

Illuminati and NWO red herrings aside, the NSA is perfectly capable of such a feat (see: differential cryptanalysis, stuxnet et al), pretending otherwise is naive to say the least.

Name: Anonymous 2011-08-18 4:20

>>33
Your shitty troll as already been unmasked, now go away.

Also, the NSA is currently most likely shitting itself over because they can't seem to convince the people in the government not to use Redmond-based OSes so that the Chinese and Russians won't hack the fuck out of all their secret data.  Who cares if you got super secure crypto algorithms if the OS you use has thousands of gaping security holes.  So yeah, they're probably too busy trying to hold their shit together and MAYBE writing a Windows virus or two in the hope that their opponents learned nothing of Stuxnet.

Name: Anonymous 2011-08-18 7:04

>>33
You're not auditing any kernel with a logic probe, you're auditing more fundamental software using a logic probe such as bootstrapping software. You can make printouts of Linux code and audit the code from the printout.

Name: Anonymous 2011-08-18 7:31

>>35
BUT THE ILLUMINATI HAVE HACKED THE PAPER MILLS TO CAUSE CANCER AND RESTLESS LEG SYNDROME SO YOU CAN'T PROVE THAT A!=B WITH MERE PRINTOUTS

CHECK MATE, NAIVE TOOL OF THE NSA

Name: Anonymous 2011-08-18 8:35

Livet, et pust i sivet.

Name: Anonymous 2011-08-18 10:18

According to my theories, all hardware design programs have been infected so all hardware contain virus. Even if one codes machine code, ones applications are still sending data to Illuminati or reptilians or some 3rd party (I'm not sure which).

That's why I'm using my own hand designed and hand built computer. Only way this could be compromised is that my brains are infected by virus.

Name: Anonymous 2011-08-18 19:37

>>38
Only way this could be compromised is that my brains are infected by virus
And you're sure they've not already done that? Remember, the Illuminati have been planning that NWO of theirs for millennia...

Name: Anonymous 2011-08-19 3:06

>>39
Crick and Watson sorted that shit out in 1953.  We're all royally fucked.

GATTACAGATTACAGATTACA

Name: Anonymous 2011-08-19 6:23

Never thought I'd see the day when Alex Jones fans would be posting on /prog/

Don't change these.
Name: Email:
Entire Thread Thread List