Return Styles: Pseud0ch, Terminal, Valhalla, NES, Geocities, Blue Moon.

Pages: 1-

Ready for some DNA coding, /prog/?

Name: Anonymous 2010-05-21 13:20

Name: Anonymous 2010-05-21 13:37

AAAATCCGTATGCACCTCTGGAGCAAGACCCGTTCATTCCGCTGAATTCTATCGAAAGTTGCTACCTCATGGGTTAACTGAACGGCGATTGTGCAGGGTCAACACAACGATAG

Name: Anonymous 2010-05-21 13:45

Any DNA project of reasonable size invariably turns into horribly unstructured spaghetti code.  I'll be waiting for a higher-level language.

Name: Anonymous 2010-05-21 13:55

Venter had already applied for patents on more than 300 genes, raising concerns that the company might claim intellectual rights to the building blocks of life.
Fuck you!

Name: Anonymous 2010-05-21 14:01

>>4
the company might claim intellectual rights to the building blocks of life.
Monsanto's been doing that for years, you'd know if you went out of your basement once in a while.

Name: Anonymous 2010-05-21 14:23

>>5
By ``went out of your basement once in a while'' do you mean ``were a farmer''?

Name: Anonymous 2010-05-21 15:33

The human genome is about 3 gigabases long, which boils down to 750 megabytes. Depressingly enough, this is only 2.8 Mozilla browsers.

Name: Anonymous 2010-05-21 16:04

So, someone crack the code already.

Name: Anonymous 2010-05-21 16:07

>>7
To be fair, Mozilla comes bundled with documentation.

Name: Anonymous 2010-05-21 16:38

>>7
Perhaps, but the Human Genome is a shitty web browser

Name: Anonymous 2010-05-21 16:43

>>8
Give me access to encoded material and I'll crack it.

Name: Anonymous 2010-05-21 16:52

>>10
What do you mean? You could say it's a meta-browser, as it can create browsers itself.

Name: Anonymous 2010-05-21 16:56

>>11
That's part of the challenge, you fool.

Name: Anonymous 2010-05-21 17:11

That's preposterous. They only tell you they ``developed'' a way to encode the English alphabet and punctuation using four different symbols. I can think of at least ten different useful implementations.

And an obscene amount of impractical and ridiculous implementations.

Name: Anonymous 2010-05-21 17:24

>>14
Not really, there are patterns in natural language that are easy to spot, regardless of encoding. At most it's a 16-bit encoding, much less if I remember rightly that certain combinations of ACGT aren't possible.

Name: Anonymous 2010-05-21 17:56

I, for one, welcome our new demise by the grey goo.

Name: Anonymous 2010-05-21 18:10

Is it a perfect lifeform? ie no diseases, no errors, no mutations? Sounds like it's going to be pretty boring when all life on earth is dissolved into mindless self-replicating proteins.

Name: Anonymous 2010-05-21 18:14

>>14
Well I have a way to encode the English alphabet and punctuation using two different symbols.

Name: Anonymous 2010-05-21 19:25

>>18
OH WOW THATS AMAZING

Name: Anonymous 2010-05-21 23:10

Anyone see the resemblance between base64 and 43 encoding of amino acids?

Name: Anonymous 2010-05-22 2:07

>>17
Self-replicating proteins are mindless by nature.

Name: Anonymous 2010-05-22 3:08

And yet... if you get enough of them together in the right proportions.

/prog/ happens.

Name: Anonymous 2010-05-22 7:17

>>17
replicants

Name: oiu !TOOy4UqVgE 2010-05-22 15:36

gum

Name: Anonymous 2010-05-22 19:06

Recompiling the kernel is not exactly "creating synthetic life."


Still cool though, and one day it might even be quicker just to create a synthetic E.coli in this manner containing the genes you want, rather than having to construct plasmids and transform them.

Don't change these.
Name: Email:
Entire Thread Thread List